Pri mers designed and utilized for canine STAT3 transcrip tional targets VEGF a

When necessary, AP24534 価格 membranes were stripped with Blot Restore Kit and reprobed with anti actin antibody. Prestained molecular weight standards were used. For the quantification analysis, the bands from at least three separate experiments were scanned using a Chemidoc apparatus and quantification performed using the Quantity One software. P values were cal culated using a t test. Real time qPCR The TaqMan Gene Expression Cells to CT kit was used to extract total RNA and to perform reverse transcription and gene amplification. An Applied Biosystems Custom TaqMan Gene Expression Assay was used, the sequences were chosen to cover exons 5 and 6 to avoid detecting genomic DNA, sense primer, 5 ccatcttcatca cactcttcctgtt, antisense primer, 5 accaccgaggagaagatcca, 5 FAM probe, 5 ctacagtgccaccgtcacc.<br><br> For the TaqMan Gene Expression Assay ref. Hs00941525 g1 was used. For cyclophilin A, used as a reference, the TaqMan Gene Expression Assay, ref. Hs99999904 m1 was used. All steps were performed following AT7519 溶解度 the recommendations of the manu facturer. Relative expression levels of each gene were calculated as previously described. Transfections Cells were grown in 4 well plates to a density of 0. 5 106 cells mL. When the cells reached 50 60% confluence, they were transfected with STAT3 decoy ODN or the hairpin control decoy ODN in 150 uL of DMEM medium com bined with the liposomes. After 6 h at 37 C in a humidified 5% CO2 incubator, the cells were placed in fresh serum containing medium. Expres sion was analyzed after 48 h. In other cases, transfection was performed using polyethyleneimine, with an ODN to polyethyleneimine ratio of 1,1.<br><br> Flow cytometry, cell viability, immunocytochemistry To measure cell death, cells were resuspended in annexin V binding buffer, incubated with 5 uL of propi dium iodide and subjected to flow cytometry analysis, using a BD FACS Canto II Flow Cytometer. Cell viability was also assessed using the trypan blue exclusion method with a V cell counter. For immunocytochemistry, buy Alisertib cells were grown in 8 well plates to a density of 0. 5 106 cells mL. At 50 60% confluence, cells were transfected with the FITC labeled STAT3 decoy ODN or the FITC labeled mutated STAT3 decoy ODN. After 48 h the cells were washed in NaCl phosphate buffer, fixed in 3. 7% formaldehyde for 15 mn, permeabilized in 0. 1% Triton X 100 for 15 mn and blocked in 5% FCS, 0.<br><br> 1% Tween in NaCl phosphate buffer for 1 h. Cells were stained with anti STAT3 antibody or anti phosphotyrosine 705 STAT3 antibody for 2 h and Alexa Fluor 546 labeled secondary antibody for 90 mn. After counterstaining with 4, 6 diamidino 2 phenylindole coverslips were mounted onto glass slides with Vectashield. Fluorescence images were acquired using a Zeiss Axioplan2 Deconvolution microscope and analyzed with Meta fer4. Oligodeoxynucleotide pull down Nuclear protein extracts were obtained as follows, 20 million cells were resuspended in lysis buffer at 4 C for 20 min. The lysates were centrifuged at 14 000 × g for 5 min at 4 C, and the supernatants containing the cytoplasmic pro teins were discarded. The pellets were resuspended in the cell lysis buffer adjusted with 20% glycerol and 0. 35 M NaCl for 30 min at 4 C.